                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-26.00 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-25.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAACAGCGTCAGTACGTACTCGCCGCGGGTCGTATTCAGGAAGAAGTTGGTGTTTT
CGATGCCGGCGGTGATGCCGCGCAGTGAAACCAGGTCTCCGAGGTCGAAGCGGGCCAG
CAGGGTGCGGGCGTCCTGGTCGGAAACGGAAGTGAAAACGGCCATtgatctgcggggtgaggggttg
gagagacgcttatcgctgcgctgcgcggggattgtagaccaccggacgcgtggccgcggccggcggcccggcccgcaggccgtaaaatacggcatgtttt
tgccctgcgagtgattcTTG

    BP1085 Gene: BP1085     GI: 33592223     BI number: BP1085     GOG: COG0042     Description: conserved hypothetical protei gt t  a t  g a  a gc gc |  a |  c |  c |  g |  g g  a gc         g cg       g  c gc        cg cg        cg g  t       gc t  g       gc cg       c  | gc        gc |  c       cg cg        cg gc        gc tg        gc         a cg       t  |      a  a gc        gc        at c  c       cg        ta t  |       gc        gc a  |      |  a       cg t  |      c  g       cg tg       a  g       gc cg        gc       g  a gc        gc        at cg        cg        cg                         tttttgccctgcgagtgattcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here     ..................................................................................................................