                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-17.30 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGACGGAGGCATCAGGCTGTTGGCCAGGAAGTCTTCCAGCGCAACCCGGAATTCCTG
GAATACGGGAAACGCCGTGAACAGCGACAGCACGACGGCCAGCATCGGCACGATGGCC
AGCACGGTGGTGAACGTCAGGCTCGAGGCCACCTGCAGCAGCTTCTGCTCGTCGGCGC
GCTGGCCAGCGAAGCGCACGACCCGGCCCATGCGCGTGAACCATGAGGCGCGCCGTTT
TTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataat
agcagcATG

    BP1089 --- BP1090 Gene: BP1089     GI: 33592227     BI number: BP1089     GOG: COG3308     Description: putative membrane protein Gene: BP1090     GI: 33592228     BI number: BP1090     GOG: COG0397     Description: conserved hypothetical protei             C           G  G           A  C           A  A            GC            CG        CC GC       |  A      A  A C  G      |  C      A  T GC       G  C      G  G GT       A  C      T  A CG        CG       G  G TG        CG        CG GC        GC        GC C  C       GC        CG TA       |  C       GC CG       |  A      T  | GC       T  T      A  | T  |       CG       C  | CG        GC       C  | TA        CG        CG TA        GC        GC CG        CG        GC GC        GT        CG                         TTTTTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataatagcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3308 Predicted membrane protein ... can be seen here [S] COG0397 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................