                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-13.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-24.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGAAGCCGGCGTGGCGGTGATCGACGGCACGCCGTATGGCGTGCCCGGCACCTTCC
GGCTTTCTTTCGCAGCGGCGCTGGAGGATATCCAGCAAGGCTGCGCGGCCATCCGCGC
GGCGTGCGAACGCCTGGCCTGAgcgcaacccgatcggcggcgggcccgcgcccgccgcggctttttcgacaaccaacaagggga
tcgatgatgaaacgcaatgttcttgccgtgctgacgataagcctgctcggcctggccggcccacgccgaccagctcgacgatatcaaggcgcgcggcgaa
TTG

    BP1184 Gene: BP1184     GI: 33592314     BI number: BP1184     GOG: COG0834     Description: probable solute-binding protei CG G  A TA GC CG GC GC C  | G  | C  | G  | C  | C  | T  | AT        cg CG       c  a CG       c  t GC       a  c GC       a  g |  T       cg        cg |  G       gc       c  c |  A       cg        cg Cg       g  g       gc Gc       A  |       gc Cg        Gc        gc Gc        Tg        cg Ta        Cg        gc C  a       Cg        gc Gc        Gc        cg Gc        Gc        gc                         ggctttttcgacaaccaacaaggggatcgatgatgaaacgcaatgttcttgccgtgctgacgataagcctgctcggcctggccggcccacgccgaccagctcgacgatatcaaggcgcgcggcgaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................