                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATCCACACCCGCGAAACCGTCGAAATCGACGGCAAGACGTACCCGCTCTTCAAGTG
CGACGTGACGTCCGAATCGCACCCGTTCTACACCGGCGCGCAGACGCGTATCGTCGAG
ACCGGCCGCGTGGAAAAATTCCGCGCCCGCTTCGCCCGCACCGCCGGGACGGTCAAGT
CGGCGTCCTGAtcggcaagctccttcgggaggcgcaccagaaagcagcctgcgggctgcttttttttcctcgcggcatgccgcgccaaccct
catcggttccacgctcgtcggttacattacgtccGTG

    BP1231 --- norM Gene: BP1231     GI: 33592359     BI number: BP1231     GOG: COG1807     Description: putative membrane protein Gene: norM     GI: 33592358     BI number: BP1230     GOG: COG0534     Description: multidrug resistance protei            gc ag       t  g c  a       cg c  a       cg a  a       gc cg        at gc        cg |  a       gc cg        at gc        at gc        at             tttttcctcgcggcatgccgcgccaaccctcatcggttccacgctcgtcggttacattacgtccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1807 4-amino-4-deoxy-L-arabinose transferase and related glycosyltransferases of PMT family ... can be seen here [V] COG0534 Na+-driven multidrug efflux pump ... can be seen here     ..................................................................................................................