                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-22.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.51 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCGGCCCTGCTGCAGCTGCCCAGCGCCATCGTGCCGTGCCGCGGGGTGCCGGACTG
CAATCTGCTGATCAATCCGCAGCATCCCGATGCCGCGAGCGTGCGGGTGGCGCGGCGC
GAGAAGTTCATCTACGATCCGCGCCTGGCGCCCGGCGGGCCGCGCCAGTGAgggccatgccc
cgcggcgccacgtcctgtacccgtcccgcggcagcctgatccccttgccgggcgcagggctaccggcccggccgcgcggcccgtgcggcacaatgggatt
tttggcgcaaggcgaggcggcaATG

    BP1292 Gene: BP1292     GI: 33592415     BI number: BP1292     GOG: COG1464     Description: putative exported protei at g  c t  c c  c c  c gt at cg gc gc c  |        c         c g  |      a  c      g  c c  |      t  g       gc c  |       cg        cg c  |       gc        gt t  |       gc        cg g  |       gc        gc cg       a  g       cg cg        cg        cg cg        gc        gc a  c      |  c      |  a t  g       cg       |  c gc        gc       |  a ta       g  g      |  a cg        gc        gt cg        cg        cg tg        cg        cg gc        gc        cg                         atttttggcgcaaggcgaggcggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here     ..................................................................................................................