                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTGGAGAATACGCGCGACCTTACCGTGCCCAATGGCGTGCTCAATATCAGCGCCGA
AAATCACCAGGGTTTCGACGAGCGCGCGCGCGTCATGGGCGTGGTGCGCAACGGGCGT
TTTTCGTACGCTGGCCAGCCGTAGgcgtttcaggatgtgacgcgccggtttccctgggcgcggcaatgcgggcaggccttgg
gcctgccttttttgtcgtcaaatgattcgtgatcaaatgattttatagcgtactattcgggacatatctatttcaataccgaactattcaggaggaaaaa
ccATG

    BP1507 --- BP1508 --- BP1509 --- BP1510 Gene: BP1507     GI: 33592598     BI number: BP1507     GOG: COG0834     Description: putative extracellular solute-binding protein Gene: BP1508     GI: 33592599     BI number: BP1508     GOG: COG0765     Description: putative inner membrane component of binding-protein-dependent transport system Gene: BP1509     GI: 33592600     BI number: BP1509     GOG: COG0765     Description: putative inner membrane component of binding-protein-dependent transport system Gene: BP1510     GI: 33592601     BI number: BP1510     GOG: COG1126     Description: putative ATP-binding component of ABC transporte            cc           c  t           t  g   a        tg g  t       tg g  g       gc at       |  g cg        gc ta        cg t  c       cg tg        gc gc       |  a cg       |  a gc       |  t Gc        cg A  |       gc T  |       cg         t G  |      a  g      t  g Cg       g  |       cg Cg        tg        cg Gt        gc        gc At        ta        gc C  t      |  g       at C  c      a  g       cg Gc        gc        gc Gc        gc        gc                         ttttttgtcgtcaaatgattcgtgatcaaatgattttatagcgtactattcgggacatatctatttcaataccgaactattcaggaggaaaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here     ..................................................................................................................