                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-28.50 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTACCGGGTGGGCATCAGCCCGCCTTCGTTCGACAAGCAGTTCGTGCGCGACTGGC
TGGAAACCCAGCCCTGGGACAAGACCCCGCCCGCGCCGCGCCTGCCGCGCGACGTGCT
GGAAAAGACCGCCGCCAAGTACCGCGAAGCGCTCGACCGCCTGCTCGCCTGAgccctgccg
gcgccgtccaggcccgccgcccttcggggcgcgcgggcttttttcattggaggcgcggcgacaaaaaagccgggacaaaagcgtcgcgccggggcggcgg
cgctggggctggatttcagcgccATG

    BP1522 --- BP1523 --- BP1524 --- BP1525 Gene: BP1522     GI: 33592613     BI number: BP1522     GOG: NOG08272     Description: conserved hypothetical protein Gene: BP1523     GI: 33592614     BI number: BP1523     GOG: COG1396     Description: putative DNA-binding protein Gene: BP1524     GI: 33592615     BI number: BP1524     GOG: -------     Description: putative membrane protein Gene: BP1525     GI: 33592616     BI number: BP1525     GOG: COG1495     Description: putative membrane protei CC G  T CG TA Cg Gc |  c T  c C  t Cg Gc C  |                 tc C  |                t  g A  |                 cg Gc         c        cg Cg       t  c       cg T  |      g  a       gc Cg        cg        cg Gc        cg       |  c Cg        gc        cg Gc       |  c       gc A  |      |  c       cg A  |       cg        cg Gc        gc        cg Cg        gc        gc Gt        cg        gt                         tttttcattggaggcgcggcgacaaaaaagccgggacaaaagcgtcgcgccggggcggcggcgctggggctggatttcagcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here [O] COG1495 Disulfide bond formation protein DsbB ... can be seen here     ..................................................................................................................