                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-21.70 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-28.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGCGGCCCGGCCTCGGCTTTGAGGCGCAGGTACTGCTGCATCATGGGAGTATGGCC
GGCCAGGGCGTCGCCGGTGGTTTGCTTTGGTGTGGAAGACATaggcaggattgtatcgggccgcccgcg
cggtccgccatgcggcaggcgccgggccgccatggtgtcgcgcgatgacgcattgcgcaacatccggtgctgtgcgccgtttcttccctgtgctcaaatg
aatcagccggcggcgcagtgcgcgcacgaggcgcgtccggtcggcggccagcaaccgtacaaggagcaacgccATG

    BP1565 Gene: BP1565     GI: 33592655     BI number: BP1565     GOG: COG3360     Description: conserved hypothetical protei   g c  c        c g  c      a  g g  g       gc a  g       ta cg        at gc        gt gc        cg cg        gc |  c       cg gc        gc ta       c  a at        ta cg        gc cg        ta gt        gt cg        gc c  |      t  c t  |      a  |        g gt        cg       t  t gc        cg        cg cg        gt        gc gc       c  |       tg cg        cg        gc gc        gc        gc cg        gt        cg                         tttcttccctgtgctcaaatgaatcagccggcggcgcagtgcgcgcacgaggcgcgtccggtcggcggccagcaaccgtacaaggagcaacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3360 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................