                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCACCAGGATGCGCGCCTGTACGCGGGCCTGTTCGACGGCACGGAAAGCGCCGAGCTG
CCGTTGGCGGCCGGACGCCGCTCGTGGGTGCACGTGGCGCGCGGCAGCCTGGTCGTCA
ATGGCCAGAGGCTGGGCGCGGGCGATGGCCTGGCGCTGCAGGACGAGGCCGCGGTGCG
GCTGGGCGACGGCGAAGGCGCCGAAGTCCTGGTATTCGATTTGCCGTAAagtgagacgggcgcc
gccagccggcgcccatttttccacggcgcggccgcgcggccagtcggtacaggaggagagccATG

    BP1601 Gene: BP1601     GI: 33592690     BI number: BP1601     GOG: COG1741     Description: conserved hypothetical protei AG A  G GC CG GC GC CG A  A G  A       gt CG       a  g GT       A  a GC       A  g GC        Ta |  T       Gc TG        Cg CG        Cg GT       G  g |  A      T  | |  T      T  | |  T      T  | GC       A  |        a CG        Gc       c  g |  A       Cg       c  c |  T      T  c       gc |  T      T  c       cg G  T      A  |       cg TG        Tg        gc GC        Gc        cg GC        Gc        gc CG        Ta        gc GT        Cg        gc                         atttttccacggcgcggccgcgcggccagtcggtacaggaggagagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1741 Pirin-related protein ... can be seen here     ..................................................................................................................