Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aacgggcaaacagcagggtcatgaccggcgctccgagcatcacgcccaccgcgtaggccgagatcagcatgcccgcgctgggaatgcttacctgcacacc
gtcggcgatgacgggcagcagccccatcggcgtgaactccgtggtgccgatggcgaatgcgccggtggccagggcaaacaatgcggccgaggatttcatc
gccgcttctccttgaaaaagtccaatggcgacagtgtgccgggtttatatttgcggattaagctctgtatgaaccaaattcttttgatttgaattcaaca
ATG

    BP1607


Gene: BP1607     GI: 33592695     BI number: BP1607     GOG: COG0583     Description: probable LysR-family transcriptional regulato



 ag
c  t
a  g
 gt
 cg
 gc
 gc
t  |
a  |
a  |        t
 cg       a  t
 cg       g  a
t  g      g  a
g  t       cg
 at        gc
 at       |  t
|  a      t  c
|  t      t  t
a  a       tg
 at        at
 at        ta
 gt        at
 tg        tg
t  c       ta
 cg        ta
 cg        gc
 ta        gc
            aaattcttttgatttgaattcaacaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here

    ..................................................................................................................