                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.69 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAGACGGCGCGGGCGGCCTTCGACAAGGCCGACGCGGCCAACGACCAGCCCACTGC
CGATCTGCTCACGCAGCGGCTGGACGTGCACGAGAAGAACGCCTGGATGCTGCGCAGC
CTGCTGCAGTAAcgcgcggcgcgcagaagaaaagccggcatcgagagatgccggcttttttcttgccgggtgcctgtccccgcatggggac
tggcacccgcaaacttcacgcctgcccccgcatgggggacgaacgcgccgagccaggactcaggcgggcgcactttgcaggaagcgctccaggATG

    BP1617 Gene: BP1617     GI: 33592703     BI number: BP1617     GOG: -------     Description: C-terminal region of a putative polysaccharide biosynthesis protein (partial             g           g  c            cg            gc GC        cg T  A       gc CG       c  a GT       A  g       ag TA       A  a      g  a C  A      T  a       cg C  c      G  g       ta G  |      A  a       at A  |      C  a       cg Cg       G  a       gc Gc        Ta        gc Cg        Cg        cg Gc        Gc        cg Tg       T  c       gc Cg        Cg        at Gc        Cg        at Tg        Gc        at                         tttcttgccgggtgcctgtccccgcatggggactggcacccgcaaacttcacgcctgcccccgcatgggggacgaacgcgccgagccaggactcaggcgggcgcactttgcaggaagcgctccaggATG     ..................................................................................................................