                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCACATCGCCAGCCGCGTCACCGGGCAGCCATGAcaagcgtggttacctgagcccgtcaaagcggctcaattc
tttgctcaaatgtaacttgggccggcgcaagccggccttttttctccctgcgcaaaacgtatcgccagccacgccgggccatttacatttccccacacgc
cggtttgacaccgccaccgccccctcttacggtagaaccgtacgctgatcagtgtccacactcactcgcggcaaggcattcggcaggcacggatcccgcg
ccgcaacgacctagaagaggacaaccATG

    BP1738 --- BP1737 --- BP1736 Gene: BP1738     GI: 33592808     BI number: BP1738     GOG: COG3237     Description: conserved hypothetical protein Gene: BP1737     GI: 33592807     BI number: BP1737     GOG: COG5487     Description: putative membrane protein Gene: BP1736     GI: 33592806     BI number: BP1736     GOG: COG2823     Description: putative exported protei            aa           c  a           t  t            cg            gt            ta            ta           t  c           c  |           t  |           t  |            at            at            cg            tg            cg aa        gc c  a       gc        ca tg        cg       g  a gc       g  |       cg c  |      a  |       gc cg       a  |       gc cg       a  |       cg gc       c  |       cg at        tg        gc gc        gc        gc ta        cg        gt                         tttttctccctgcgcaaaacgtatcgccagccacgccgggccatttacatttccccacacgccggtttgacaccgccaccgccccctcttacggtagaaccgtacgctgatcagtgtccacactcactcgcggcaaggcattcggcaggcacggatcccgcgccgcaacgacctagaagaggacaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3237 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG5487 Small integral membrane protein ... can be seen here [R] COG2823 Predicted periplasmic or secreted lipoprotein ... can be seen here     ..................................................................................................................