                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:205 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.61 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTGCGCAATTATTGGCCAATCGTTGCGCAAATCTGACATTGAGCGGCCCCTACGTG
CAGCTGCGGCCGGATGTGCATGGCACCGACGGCTTTTTCGCCGCGGTGTTCGAGCGCC
GCAAGCCATCCGCGGCGGCCACGCAGGAGCCTGCGGACGTGGCGGCCGAAACCGGGCC
CGGCGAGCCGGAAGACGCGGCCGGCTAGttgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgag
aaactggaaatcgccacccccccagttcactcaaggagcccggccggATG

    BP1757 Gene: BP1757     GI: 33592824     BI number: BP1757     GOG: -------     Description: transposas            GC           A  T            CG            GC           T  |           G  |           C  |           A  |   G       T  | T  A      C  | GC       C  | TA        CG AT        CG gT        GC g  G       GC         T c  A       CG       A  G cG       G  |       CG gC       A  |       GC g  |      G  |       TA c  |       TG        GC cG        TA       T  C cG        AT       A  G gC        CG       G  A a  C       AT        GC gC       |  G       CG gC        GC        CG aT        TA        GC                         TTTTTCGCCGCGGTGTTCGAGCGCCGCAAGCCATCCGCGGCGGCCACGCAGGAGCCTGCGGACGTGGCGGCCGAAACCGGGCCCGGCGAGCCGGAAGACGCGGCCGGCTAGttgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG     ..................................................................................................................