                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-13.81 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taggaaatacagtATGGAAACCGGCGTCGTTAAGTGGTTCAACGCGGAAAAAGGTTATGGCTT
CATCACCCCGGAAGCGGGCGGCAAGGATTTGTTCGCGCACTTCTCGGAAATCCAGGCC
AATGGCTTCAAGTCGTTGGAAGAGAATCAGCGCGTCAGCTTCGTGACGGCGATGGGCC
CGAAGGGTCCTCAGGCGACGAAGATCCAGATTCTGTAAgaatctgagcgcgtccataaaagcccccgccagg
gggctttttcattgcttggcccaagcggccaattccgcaggagcacgacATG

    BP1771 Gene: BP1771     GI: 33592838     BI number: BP1771     GOG: COG3803     Description: conserved hypothetical protei             T           G  A           T  A            Cg            Ta            Ta   A        At G  A       Gc CG        At CG        Cg CG       C  a GT       T  g GC       A  c GC       G  g T  |      A  | AT       A  | GC        Gc |  A       Cg C  G       At G  G       Gc GC       |  c CG       |  a A  |      |  t       cc G  |      |  a      g  a TA       |  a       cg GC       |  a       cg CG       |  a       cg TA        Cg        cg TA        Gc        cg CG        Gc        gc                         tttttcattgcttggcccaagcggccaattccgcaggagcacgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3803 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................