                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGGTGCTCGACTATCTGGAAGACGCCTGTCAGGGCGTGCTGGAACTGGTGCGCAAG
CGCGCCACGCAATACCAGGCGGCCTGAtccgtcgccgtccgcggcgctggggcaagtggggggatccgcaatgggtccgt
accccaaaatgagaaaaccgcgcgactgcgcggttttttccgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggt
attgatgcccggtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG

    BP1798 --- iscS --- iscU --- iscA --- hscB Gene: BP1798     GI: 33592860     BI number: BP1798     GOG: COG1959     Description: putative DNA-binding protein Gene: iscS     GI: 33592861     BI number: BP1799     GOG: COG1104     Description: cysteine desulfurase Gene: iscU     GI: 33592862     BI number: BP1800     GOG: COG0822     Description: [Fe-S] cluster formation/repair protein Gene: iscA     GI: 33592863     BI number: BP1801     GOG: COG0316     Description: [Fe-S] cluster formation/repair protein Gene: hscB     GI: 33592864     BI number: BP1802     GOG: COG1076     Description: chaperone protei ct a  t t  g a  a t  c c  c gc ta ta t  t a  t a  a gc        cc gt       c  g gc       g  g cg       t  t tg       a  c cg        gc at        ta ta        tg        gc |  t      a  c      t  g t  t      t  g       at tg        gc        gc ta        gc        cg gt        gc        cg cg        cg        cg gc        ta        gt                         tttcttccggattcacaggaaacacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here [E] COG1104 Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes ... can be seen here [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here [S] COG0316 Uncharacterized conserved protein ... can be seen here [O] COG1076 DnaJ-domain-containing proteins 1 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-12.10 kcal/mol Antiterminator: Size=70 nt.     Delta G=-28.54 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-20.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAAGGTGCTCGACTATCTGGAAGACGCCTGTCAGGGCGTGCTGGAACTGGTGCGCAAG CGCGCCACGCAATACCAGGCGGCCTGAtccgtcgccgtccgcggcgctggggcaagtggggggatccgcaatgggtccgt accccaaaatgagaaaaccgcgcgactgcgcggttttttccgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggt attgatgcccggtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG     BP1798 --- iscS --- iscU --- iscA --- hscB Gene: BP1798     GI: 33592860     BI number: BP1798     GOG: COG1959     Description: putative DNA-binding protein Gene: iscS     GI: 33592861     BI number: BP1799     GOG: COG1104     Description: cysteine desulfurase Gene: iscU     GI: 33592862     BI number: BP1800     GOG: COG0822     Description: [Fe-S] cluster formation/repair protein Gene: iscA     GI: 33592863     BI number: BP1801     GOG: COG0316     Description: [Fe-S] cluster formation/repair protein Gene: hscB     GI: 33592864     BI number: BP1802     GOG: COG1076     Description: chaperone protei             a           c  a           g  t            cg            cg            tg            at            gc            gc cc       |  g t  g      |  t gc       |  a cg        gc cg        gc gc        gc cg        gc t  c       ta gt       |  a cg       g  a cg       a  a tg        at |  g       cg |  c      g  a |  a      g  g |  a      g  a A  g      g  a Gt       t  a Tg       c  a Cg       g  | Cg       c  | |  g       gc        ac |  g       gc       g  t |  g       cg        cg |  a       gc        gc |  t       cg        cg Gc       |  c       gc Gc        cg        cg Cg        ta        cg Gc        gc        at                         tttttccgaccgagatacttagcgttttactcgggaatttgctatacttgacccaattactcgggtattgatgcccggtccagcgcccgatgcgtcgggttttcttccggattcacaggaaacacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here [E] COG1104 Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes ... can be seen here [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here [S] COG0316 Uncharacterized conserved protein ... can be seen here [O] COG1076 DnaJ-domain-containing proteins 1 ... can be seen here     ..................................................................................................................