                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-37.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCCACGGCACAGCCCGCGGCAGCCTCTGCCGCGGCGTCGCAACCCGGCGAAGGCC
GCTCCCTGTCCGGCGTCTCGGGCGTGCGGCTGAATTCCTACGATTAAcccgggtgcctgtcccca
cagggacaggcacccgggcctccctgttcctgctcctccacctgatcacgtgccgcccaccggggcggcatttttttgctcggggttttccctgaaattc
tcataaattgagaatgaattctgaaaaaatgggaaaaactgaataatctgcgcacgcaatatcaaggaacgatcgacATG

    BP1851 Gene: BP1851     GI: 33592909     BI number: BP1851     GOG: COG1414     Description: probable transcriptional regulato            cc           t  t           c  c            gc            ta ac       |  c c  a      |  c cg       c  t cg        cg cg        ta ta       t  t gc        gc ta        ta        cc cg       |  c      a  g cg       c  g       cg gc       c  t       cg ta       c  g       cg gc       t  c       gc gc       c  c       cg gc        cg        cg cg        gc        gc cg        gc        ta cg        gc        gt                         ttttttgctcggggttttccctgaaattctcataaattgagaatgaattctgaaaaaatgggaaaaactgaataatctgcgcacgcaatatcaaggaacgatcgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1414 Transcriptional regulator ... can be seen here     ..................................................................................................................