                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-17.02 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.73 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGACCTGGAGGCGATCCGCGCCGCCGGCTACGCGGTCAGCGACAGCGAGGTCGAC
GCCGGCGTATGGGGCTGCAGCGCGCCGGTGTTCGAGCGGCCGCACCAGGCAGCCGGCT
CGGTCACCCTGATGGCGCCTTCCACGCGCGTGGCCGAACGCACCGCGAACCTGATCAA
CCTGACGCTGGCGGCCGCCAAACGCATTTCCAGCCGCCTGCAGCATTCCTGAtgtatccct
gtggccgtatccatccatacggttttcttcactccaatgccgcacccatcaccaaaggaagcatcATG

    BP1852 Gene: BP1852     GI: 33592910     BI number: BP1852     GOG: COG0834     Description: putative glutamine-binding periplasmic protein precurso             G           T  C           C  A            CG            GC           C  A           C  T           G  T           A  C           C  C           C  T           T  |            TG   G        TA C  C       At A  A       Cg A  T       Gt A  T      |  a C  T      C  t C  C      A  c G  C      A  c C  A      A  c       at CG       C  t      c  c GC        Cg       c  c GC        Gt        ta CG        Cg        at GC        Cg        ta GC        Gc        gc T  T       Gc        cg CG        Cg        cg GC        Gt        gt                         tttcttcactccaatgccgcacccatcaccaaaggaagcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................