                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.59 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGATCCCAAGATCAGGGAAACCTGGGCGGGCAACGGCTCGGCAATCCCCGACCTGA
CCGGCCCGCAGTTCGGCGCGTTCGTCGACAGCGAGGTGACGCGCTGGGCCAAGGTGGT
CAAGGATTCGGGCGTCACGCTGGACTGAgcgggtgtacagtgagggacgaaaggggagcggcgccggccggcgcggctc
ttctttcatcgctggttccgtattgcaggcggcctggccgcgggatcgcatggcgcgggcttgcccgtgcgcgagccccggcgggcccttttcaaggagc
gtgtgATG

    BP2067 Gene: BP2067     GI: 33593087     BI number: BP2067     GOG: COG2032     Description: putative superoxide dismutas AC        ga G  T      c  a G  G      a  a TA       g  g Cg       g  g Gc       g  g Cg       a  g A  |      g  a Cg        tg Tg        gc        gc Gt       a  g      g  c Cg       c  |       cg Gt       a  |       cg |  a       tg        gc |  c       gc        cg |  a       tg        gc G  g       gc       g  g Gt        gc        cg Cg       g  g       gc Ta        cg        at Tg        gc        gc                         ttctttcatcgctggttccgtattgcaggcggcctggccgcgggatcgcatggcgcgggcttgcccgtgcgcgagccccggcgggcccttttcaaggagcgtgtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2032 Cu/Zn superoxide dismutase ... can be seen here     ..................................................................................................................