                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-23.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCCTTCCTGGCCGCCGGCGTGGGCAGCGCGCTGATCTTCGCGCTGATCGACCCGCTG
GACGTGGCCATCTTCGGCCAGGTGCCGACCAGCCGGACCGGGTTCTATACCGTGTCCT
TCTTCGTGCTGTGGCTGGTGACGGCGCTCTCCAGCACCGTTACCGCCTACCTGATGCC
GCCTGGCGGCCAGGACGAGACGCCGTTCTGAagcgccgtgtttgttgcgacgcagcaaacacgacccgcgcaagccg
gtaagatcgccgcctgccatcacgttgaacagggggcgacgggcgtatcGTG

    BP2176 --- BP2177 Gene: BP2176     GI: 33593181     BI number: BP2176     GOG: COG0730     Description: putative inner membrane protein Gene: BP2177     GI: 33593182     BI number: BP2177     GOG: COG3153     Description: conserved hypothetical protei TC C  C TA CG GC C  A GC GC CG AT GT TA GC GC                  AC T  |                G  G CG                 A  C GC                  GC GC                  CG |  T        T        AT TA       C  G       GT GC        CG        GC |  C       GC        AT |  T       CG        CG |  G       CG       |  A |  A       GC       C  a T  T      T  |      G  g CG       A  |       Gc GC        GC        Cg T  |       TA        Gc GC        CG        Gc CG        CG        Tg                         tgtttgttgcgacgcagcaaacacgacccgcgcaagccggtaagatcgccgcctgccatcacgttgaacagggggcgacgggcgtatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0730 Predicted permeases ... can be seen here [R] COG3153 Predicted acetyltransferase ... can be seen here     ..................................................................................................................