                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCCGCGTTCGGCAAAACCGGTGACGTATTGGTGGTCGATCCGACGTCGGAGTTCT
TCCAGTTCTTCAAGAACCCCGGCAAGGGCGCGGCGGGCGCCCCGGCACCGGCGAATTG
Acgccggcgcggtaaagtagggcggttcgggacaacccctaggaacagggtgccgatccatgtacaataccgcgtaagctagaaaacattccgcatacgg
ctgagcgggcttacgccctctcagccgtttttcgtttgggcaacgcccgcgcatgttccgggcgtgattcaggtatagaaatccATG

    BP2189 Gene: BP2189     GI: 33593193     BI number: BP2189     GOG: COG3705     Description: putative tRNA synthetas ta g  a cg gc c  t       at c  a      c  a a  g       gc t  a       cg a  a       cg a  a      t  c c  |      t  | a  |       at        ta ta        cg       t  c gc       a  a       cg ta       a  g       gc at       a  c       gc c  |      a  g       gc c  |      g  |      c  t t  |      a  |       gc at        tg        at gc        cg        gc c  c       gc        ta cg        at        cg gc        at        gc ta        ta        gc gt        gc        cg                         tttttcgtttgggcaacgcccgcgcatgttccgggcgtgattcaggtatagaaatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3705 ATP phosphoribosyltransferase involved in histidine biosynthesis ... can be seen here     ..................................................................................................................