                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -4.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCTGGAACAGTGTTTCGTAGGCCTTGTCCCAACGCTCGAACAGCGCCTCGATCAT
GGCGTCCTTGCTGCCGTAGCAGTACTGGATGCCGCCCTTGGTGACCCCCATTTCCCTG
GCGACCGCGTCGATGGTCAGGCCCTTGGCGCCGTCGCGCACGACGATGGTTTCGGCCG
CGTCGAGCACCTTGTCGCGGTCAATGCTGCGTTTTCGTCCCATgcgggcctcttttcaatacatacgt
atggatttatattataggcacgcccgttccggcgtgacttttttcaaggcattccatcATG

    BP2320 Gene: BP2320     GI: 33593314     BI number: BP2320     GOG: COG0477     Description: putative inner membrane efflux protei ta a  c cg at ta at a  g cg ta |  t |  t |  t       tt |  a      g  c |  t      c  c |  a       cg t  t       cg t  t       gc t  a       cg c  t       at ta        cg cg       |  a cg        gc gc        gt             tttttcaaggcattccatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................