                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -5.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggcggcgggcgccctagcgatcgggcaggcgttcgcggcgcggggcgggctggcggggactcgaacgatgcgcgcgccgatggcgcgccgggactgctg
gtctctgcatggggcggcgccggtcgcggcgtcggtctttttacaaggtgcttattttgttataattatacgttatttgattcaatttgacatattatgg
cgctttcgctcgcgtctgtcatttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatc
ATG

    BP2326 --- BP2325 Gene: BP2326     GI: 33593320     BI number: BP2326     GOG: COG0726     Description: putative polysaccharide deacetylase Gene: BP2325     GI: 33593319     BI number: BP2325     GOG: COG0438     Description: putative transferas             t ct       a  t g  t       gc ta        ta gt        ta gt       |  t       cg at       t  t      t  c at        at       t  t cg        tg       t  c at        ta        cg t  t       gc        gc t  a      c  a       cg t  t      a  t       gt t  a      t  |       gc t  a      a  |      t  | c  t      t  |      a  | t  t       ta       t  | g  a       at       t  | g  t       at       a  | c  |       ta       t  | ta        at        at gc        tg        cg cg        tg        at gt        gc        gc gt        tg        ta                         tttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:139 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G=-11.30 kcal/mol Antiterminator: Size=48 nt.     Delta G=-21.41 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-20.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cggcggcgggcgccctagcgatcgggcaggcgttcgcggcgcggggcgggctggcggggactcgaacgatgcgcgcgccgatggcgcgccgggactgctg gtctctgcatggggcggcgccggtcgcggcgtcggtctttttacaaggtgcttattttgttataattatacgttatttgattcaatttgacatattatgg cgctttcgctcgcgtctgtcatttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatc ATG     BP2326 --- BP2325 Gene: BP2326     GI: 33593320     BI number: BP2326     GOG: COG0726     Description: putative polysaccharide deacetylase Gene: BP2325     GI: 33593319     BI number: BP2325     GOG: COG0438     Description: putative transferas   a         c g  t      g  t cg       t  g cg        cg gc        at cg        gc gc        gt cg        gc gc       |  t c  |      |  g g  |      |  c t  |      |  a a  |      |  t g  |      |  g c  |      |  g a  |       cg a  |       cg gc        gc cg       |  g tg        cg cg        gc        tc a  a       cg       g  g g  |       gc        gc g  |       gc        cg gc       |  g       cg gt        tg        gc cg        at        cg gc        gc        gt gt        cg        gc                         ggtctttttacaaggtgcttattttgttataattatacgttatttgattcaatttgacatattatggcgctttcgctcgcgtctgtcatttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=48 nt.     Delta G=-21.41 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-22.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cggcggcgggcgccctagcgatcgggcaggcgttcgcggcgcggggcgggctggcggggactcgaacgatgcgcgcgccgatggcgcgccgggactgctg gtctctgcatggggcggcgccggtcgcggcgtcggtctttttacaaggtgcttattttgttataattatacgttatttgattcaatttgacatattatgg cgctttcgctcgcgtctgtcatttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatc ATG     BP2326 --- BP2325 Gene: BP2326     GI: 33593320     BI number: BP2326     GOG: COG0726     Description: putative polysaccharide deacetylase Gene: BP2325     GI: 33593319     BI number: BP2325     GOG: COG0438     Description: putative transferas ct a  c        t g  g      c  g g  a      a  c g  a       gt gc        gg cg        gg g  a       ct g  t       cc t  |      |  t cg       |  c gc       |  t g  g      |  g gc       |  c cg       |  a gc       |  t |  g       gg gc        cg        tc gc        gg       g  g |  g      |  g       gc |  a       cc        cg |  t       gg        cg |  g       gg        gc |  g       tc        cg gc        ag        gt cg       |  c       gc gc        gc        cg cg        cg       g  g gc        cg        gt gc        gt        gc                         tttttacaaggtgcttattttgttataattatacgttatttgattcaatttgacatattatggcgctttcgctcgcgtctgtcatttttgatcgacttaacggcagcatcgcgggaatcttgagccggcctcactggcatcgatccccatataatccggcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................