                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTGGCGCCGGGTGTGACGGTCGACGAAATCAAGGCAAAGACCCTTGCCAAGCTGGA
TGTTTCCGCTGTGAAGTAAggcgggttcatttttgtatgtaaggcgccggcgttagccggcgttttttttcgcccatggccatggc
tcgcgctgggacggcgggcgtgcggcgtgccggagaaagggtattccccgagtttgaaaatatttttcttccataaaataatcacgtaaacagatttaca
tttttgctggcccactctccgcaacccgttttgctttctccggcgccgccgcctccATG

    BP2399 --- BP2398 Gene: BP2399     GI: 33593387     BI number: BP2399     GOG: COG1737     Description: putative transcriptional regulator Gene: BP2398     GI: 33593386     BI number: BP2398     GOG: COG1446     Description: putative L-asparaginas GT T  T AT GC GC        ca T  |      t  t CG       t  t GC        gt AT        gt |  G       gt |  T       cg |  G       gt |  A      |  a |  A      g  t |  G      A  g |  T       At |  A       Ta        tt A  A      G  a      g  a Cg       A  g       cg Cg       A  g       gc Gc        Gc        gc T  |       Tg        cg T  |      |  c       cg Cg        Gc        gc Cg        Tg        cg Cg        Cg        gt At        Gc        gt Gt        Cg        at                         tttttcgcccatggccatggctcgcgctgggacggcgggcgtgcggcgtgccggagaaagggtattccccgagtttgaaaatatttttcttccataaaataatcacgtaaacagatttacatttttgctggcccactctccgcaacccgttttgctttctccggcgccgccgcctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1737 Transcriptional regulators ... can be seen here [E] COG1446 Asparaginase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:208 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.80 kcal/mol Antiterminator: Size=17 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-12.03 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGCTGGCGCCGGGTGTGACGGTCGACGAAATCAAGGCAAAGACCCTTGCCAAGCTGGA TGTTTCCGCTGTGAAGTAAggcgggttcatttttgtatgtaaggcgccggcgttagccggcgttttttttcgcccatggccatggc tcgcgctgggacggcgggcgtgcggcgtgccggagaaagggtattccccgagtttgaaaatatttttcttccataaaataatcacgtaaacagatttaca tttttgctggcccactctccgcaacccgttttgctttctccggcgccgccgcctccATG     BP2399 --- BP2398 Gene: BP2399     GI: 33593387     BI number: BP2399     GOG: COG1737     Description: putative transcriptional regulator Gene: BP2398     GI: 33593386     BI number: BP2398     GOG: COG1446     Description: putative L-asparaginas   C T  A A  A A  G A  G G  C C  A A  A G  A CG TA GC GC C  C A  T                  A G  |                A  G T  |                G  T GT                 T  A TG                 G  A GC                  Tg GC                  Cg G  A       GT        Gc C  A      T  T       Cg C  |       AT        Cg G  |       GC        Tg CG        GC       T  t GC       T  |      T  t GT        CG        Gc TG        GC        Ta CG        AT        At                         ttttgtatgtaaggcgccggcgttagccggcgttttttttcgcccatggccatggctcgcgctgggacggcgggcgtgcggcgtgccggagaaagggtattccccgagtttgaaaatatttttcttccataaaataatcacgtaaacagatttacatttttgctggcccactctccgcaacccgttttgctttctccggcgccgccgcctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1737 Transcriptional regulators ... can be seen here [E] COG1446 Asparaginase ... can be seen here     ..................................................................................................................