                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.92 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-24.40 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGACATCCGTTTCGGCGACAACCTGCCCAAGACCCGTTCGGGCAAGATCATGCGCCG
CCTGCTGCGCGTGGTCGCCAAGGGCGAGGAAATCACCCAGGACGTGTCCACCCTGGAG
AACCCCGCCATCCTCGAGCAACTGGCCAAGCCGTTGTGAtcgtgcggcgtccgcccgccggacgccgtacc
gggcgatgcgccggcaggcgcataatgccgtcagtctgtagccagccgggccggtcgcatgaccggcccgtgccttttccggctttgcatgggttttctt
gggagtactggaaGTG

    BP2408 --- ltaE Gene: BP2408     GI: 33593395     BI number: BP2408     GOG: COG0697     Description: putative integral membrane protein Gene: ltaE     GI: 33593394     BI number: BP2407     GOG: COG2008     Description: low-specificity L-threonine aldolas cg c  t gc ta a  g a  t t  c at cg gt |  a cg gc gc a  a cg        ca         c gc       g  t      c  g gc        cg       t  g cg        ta       t  c cg        gc       t  t g  |       gc       t  t cg        cg       c  t gc        cg        cg |  c       gc        gc |  g       gc        ta tg        gc        gt at        cg        cg gc       |  t       cg cg        cg        cg gc        gc        gt                         tttcttgggagtactggaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here [E] COG2008 Threonine aldolase ... can be seen here     ..................................................................................................................