                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctccttgagtgaactgggggggtggcgatttccagtttctcaaatccggttcggatgaaccatgcatacaacctattgaatcttcacagctaggcccat
gtcccggtgaaagcgcgcctgcggcgcgctttttcttgcccgttcaccgaggggacgggccggccgtgcgtccgcggatgccggctatccgaacaggccg
agccattgataatattaaataagaatcggtctcatttatgttgactatccaatgggaatcattatcattacctcagtctcaacgaccgatgaggtaaatc
ATG

    BP2414 Gene: BP2414     GI: 33593399     BI number: BP2414     GOG: COG4378     Description: conserved hypothetical protei ct t  t a  c        g a  a      c  g gc       c  t ta        cg tg        ta |  c      |  a at       g  a ta       t  g        g cg       a  c      t  c cg       c  g       cg a  c      c  c       cg a  c       cg        gc c  c       gc        cg a  |       gc        gc ta        at        cg at       t  |       gc cg        cg        at gt        gc        at                         tttcttgcccgttcaccgaggggacgggccggccgtgcgtccgcggatgccggctatccgaacaggccgagccattgataatattaaataagaatcggtctcatttatgttgactatccaatgggaatcattatcattacctcagtctcaacgaccgatgaggtaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4378 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................