                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCAACGGCGGCGAAACCAACTACGTGTCGGCGACCCTGGCCATCTATCTGGACGT
CTACAACGTCTTCTCTAACCTGCTGATGCTGTTGGGAATCTTTGGCGGCGACCGCGAA
TAAgcattcctgctgcgcagcgaaaaaggcttgccaacggcaagccttttttttcgcctccggcatgcccgaagcgggccaagtatttgatctatctg
aacaaccattcgattgcactaaacaacagacgcccctgcccctcgcacaatggcggcaccatcaccactacgacaggggaatcgccATG

    BP2425 Gene: BP2425     GI: 33593410     BI number: BP2425     GOG: COG3181     Description: putative exported protei            tc           t  c            at            cg            gc            At           A  g           T  |           A  |           A  |   G        Gc C  A       Cg GC        Gc GC       |  a CG       |  g GC       |  c G  G      |  g        a TA       |  a      a  c TA       |  a       cg |  T      |  a       cg |  A      |  a       gc TA       |  a       ta Cg        Cg        ta |  c       Cg        cg Ta       |  c       gc At        At        gc At        Gt        at Gc        Cg        at Gc        Gc        at                         tttttcgcctccggcatgcccgaagcgggccaagtatttgatctatctgaacaaccattcgattgcactaaacaacagacgcccctgcccctcgcacaatggcggcaccatcaccactacgacaggggaatcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................