                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-24.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCGTGGGCCGCGCCCTGGTGGCCGTGCTGGAAAACTGCCAGCAAGCCGACGGCAGC
GTGCGGGTGCCGGCCGTGCTGCAGCCCTACATGGGCGGCCTGACCGTTCTCGAACCTT
GAgacggccgcgccgcacgtgaaccagaaacggaacccgcgggttccgtttttcatttcggcgggccgccatgcgcgtattgcaacggcgcgcaactgg
tacaaacgcggccgggggttttcccgggttagccacaaatttgtcgcttttggcaggtaatctccgtagaacagcctaagttgatGTG

    BP2469 Gene: BP2469     GI: 33593452     BI number: BP2469     GOG: -------     Description: hypothetical protei   C A  C AT GT CG TA Cg T  | Ta Gc         c Cg       c  a Cg       a  g A  c      a  a Gc       g  a Tg        ta C  c       gc Cg        cg Gc       a  g       gc Gc       c  a      c  g Cg       g  a       cg Gc       c  c       cg G  a      c  c       at Gc        gc        at Tg        cg        gc At        gc        gc Cg        cg        cg                         tttttcatttcggcgggccgccatgcgcgtattgcaacggcgcgcaactggtacaaacgcggccgggggttttcccgggttagccacaaatttgtcgcttttggcaggtaatctccgtagaacagcctaagttgatGTG     ..................................................................................................................