                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=19 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-23.79 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGACGAGGCGCTGCTGGAGACCTTCCCCGCCAGCGACCCGATCGCCATCACGTCCG
AGGACGAGCGGGACGAGCCCGACGACAAGGTCGACGAGGCGCTGGAGGACACCTTCCC
CGCCAGCGACCCGCCCGCGCCGGCCCAGCCCGGGAAAAAATAGggccgcaacatccgggcggcgacgc
gccgtccggcggcgtcatgggagccgggctttttttcctggaaaaccggacttgaaatgggggcattcgcccccatcgttggcgcttgaagccaatttat
attctggaggactcccATG

    BP2501 --- BP2500 Gene: BP2501     GI: 33593484     BI number: BP2501     GOG: COG0576     Description: putative GrpE chaperone Gene: BP2500     GI: 33593483     BI number: BP2500     GOG: COG0526     Description: putative thioredoxi GA G  A G  A C  A C  A C  A G  T A  A                 tc CG                 g  c Cg                  cg Cg                  cg Gc                  gc Gc                 |  g Cg                  cg |  c                 gc |  a                 cg |  a                 at |  c                 gc C  a        c       |  a G  t      a  g      |  t C  c       gc       |  g Gc        cg       |  g Cg        gc       |  g Cg        gc       |  a Cg        cg        cg Gc        gt        gc Cg        gc        gc Cg        gc        cg                         ggctttttttcctggaaaaccggacttgaaatgggggcattcgcccccatcgttggcgcttgaagccaatttatattctggaggactcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0576 Molecular chaperone GrpE (heat shock protein) ... can be seen here [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here     ..................................................................................................................