Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-15.43 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTCGTGGTGTTTGGATTCGTCCTGCAGGGCTGCAACACCGTTGCAGGAATGGGCAA
GGACATGTCCGATGCGGGCAGTGCCATTACCCACGCTGCCGAGAAGTAGccggcccgcgccggc
atgatgcaagccctcggtcatccgggggcttttcttttgccgcggcgtccacggacggctggcgtcggcgcgcgtcgagtcaagtcccgatgacacattg
atccggctcggcatgtacgaattgtaggcaggccccgccacggccacactgaggcctcgtcgaacagcaggagggcctATG

    BP2530 --- BP2529


Gene: BP2530     GI: 33593513     BI number: BP2530     GOG: -------     Description: integral membrane protein
Gene: BP2529     GI: 33593512     BI number: BP2529     GOG: -------     Description: putative exported protei


 AG
G  A
C  A
 CG        cg
 GT       c  c
 TA        cg
 CG        gc
 Gc        gc
C  c       cg
A  g       cg
C  |       Gc
C  |      |  a
C  |      |  t
A  |      |  g
T  |      |  a
T  |       At
A  |       Tg
C  |       Gc        ca
C  |      |  a      t  t
G  |      |  a       gc
T  |      |  g       gc
G  |      A  c       cg
A  |      A  c       tg
 Cg        Gc        cg
 Gc        At        cg
 Gc        Gc        cg
 Gc        Cg        gc
 Cg        Cg        at
 Gc        Gt        at
                        ttcttttgccgcggcgtccacggacggctggcgtcggcgcgcgtcgagtcaagtcccgatgacacattgatccggctcggcatgtacgaattgtaggcaggccccgccacggccacactgaggcctcgtcgaacagcaggagggcctATG


    ..................................................................................................................