                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-20.50 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctttccgtcgctcgttcgacgcttcccagtccaggagatgtcATGAAGAACAAAGCTCTCATTGCTGTGCTGCTT
GCCATGGCCGCGCTGTCCGCGGGTTGCAATACGGTTGCCGGTGCGGGCAAGGATATCG
AGCGAGGTGGCGAAAAAATTCAGGGCGCGGCCCAGAAGTAGcgcaaggcggcgtagccagccgcaccgtg
cgcagccgcctgccgcgatagggcgccaaggcggctttttcattgggcgtgttgatgcataatccgtccgttgcattacttggagcaggagtcgatATG

    BP2564 --- BP2563 Gene: BP2564     GI: 33593547     BI number: BP2564     GOG: -------     Description: putative lipoprotein Gene: BP2563     GI: 33593546     BI number: BP2563     GOG: -------     Description: putative integral membrane protei             a           c  c            gc            cg           |  t            cg            gc           a  |           c  |            cg            gc        ta           a  a      a  g           t  |      g  g           g  |       cg            cg        gc            gc        cg            gc       |  c   g        cg       c  c a  c       gc       g  a t  c       gc        ta g  a       at        cg cg       a  g       cg gc       c  c       gc gc        gc        cg cg        cg        cg gc        Gc        gc                         tttttcattgggcgtgttgatgcataatccgtccgttgcattacttggagcaggagtcgatATG     ..................................................................................................................