Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-19.63 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccgtgacggtgcgcgcgcaggcggcggcgctggtcgtgtgggtagagccggcgtcgcggttgcgcacgatgctggctgtcgcgctgcaaggattttcaaa
atgggttatgattacgttcatcagaCGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCG
AAGGTCGTAGGTTCAAATCCTGCCCCCGCAACCAgatcaaaaaggcttggcgattcatcgccaggcctttttcgt
tttcgcagtcgcagctttgcgcgcttggcgcggcagggcttcttgccagccctgctcATG

    BP2567


Gene: BP2567     GI: 33593550     BI number: BP2567     GOG: -------     Description: hypothetical protei


            A
          C  A
          T  A
          T  T
           GC
           GC
           AT
           TG
           GC
          C  C
  C       T  C
G  T       GC
A  C       GC
 CG       |  G
 GT       |  C
 GC       |  A
 TG       |  A
 CG       |  C
T  |      A  C
G  |      A  A
A  |      G  g
 CG       C  a
 GC       C  t
 AT       C  c
 GC       A  a
|  A      A  a
G  T      T  a
T  A      A  a       tc
G  A      C  a      t  a
 GC        Tg        at
 GC        Cg        gc
 GC        Gc        cg
 CG        Gt        gc
|  A       Gt        gc
|  A       Cg        ta
G  G       Tg        tg
 CG        Gc        cg
 aT        Cg        gc
 gC        Ta        gc
                        tttttcgttttcgcagtcgcagctttgcgcgcttggcgcggcagggcttcttgccagccctgctcATG


    ..................................................................................................................