                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGCCATCTGGTCTCGGGCGATTTCGATTATCTGGTCAAGGCGCGGCTATCGGAAAT
GAATGAATACCGCCGCTTGCTGGGCGAGATTCTCAAGCGCCTGCCCGCTTCGGCGGAA
TCGCACAGCTACGTGGTCATGGAAGAAATCAAGGAAACCCTCTACCTGCCTGTGGACC
GCTGAatcccgccgcccgccatgaaccggggacgcttcatcttttttctgtaccattctgagccgtatttcatttcatgcccgccgtccgcgcccgc
cggcgcggcgcggcgcaggagcctcatccATG

    BP2636 Gene: BP2636     GI: 33593609     BI number: BP2636     GOG: COG2928     Description: putative exported protei AA A  C GC GC         c AT       t  c A  C      a  c C  T      A  g T  A      G  c A  C      T  c A  |       Cg A  |       Gc GC       C  c AT       C  c A  G      A  g GC        Gc GC        Gc |  T       Ta        gg |  G       Gt       g  a T  T       Tg        gc A  G      |  a       cg CG       C  a      c  c TA       C  c       at GC        Gc        at GC        Tg        gc TG        Cg        ta GC        Cg        at                         cttttttctgtaccattctgagccgtatttcatttcatgcccgccgtccgcgcccgccggcgcggcgcggcgcaggagcctcatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2928 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................