Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACCTGGCCGAGAAATCGATCGCGGCCCGCAAGAAATAAgcagcagcccaaggggaacggcggcgcaag
ccgccacgcaaggcaggggcgcacaaccctccaacccaacggacgccggccaaaagctggcgtccgtttctttttcctcccggagcctgtccccacgggg
acaggctccccgtcacacgccacgaacgctagctgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccac
ccccccagttcactcaaggagcccggccggATG

    BP2672


Gene: BP2672     GI: 33593641     BI number: BP2672     GOG: -------     Description: transposas


           cc
          c  a
          a  a
          a  c
           cg
           cg
           ta
          c  |
          c  |
          c  |        a
          a  |      a  a
          a  |      c  a
          c  |       cg
          a  |       gc
 ca       c  |       gt
g  c       gc        cg
c  a       cg        cg
g  a       gc        gc
 gc        gc        cg
 gc       g  g       at
 gc       g  |       gc
 at       a  |       gc
c  |       cg        cg
 gc        gc        at
 gc        gc        at
                        tctttttcctcccggagcctgtccccacggggacaggctccccgtcacacgccacgaacgctagctgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG


    ..................................................................................................................