                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=18 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTCGACAAGCTGCTGGCCGAGGCGCGCACCGTGCCCGACCAGGCCAAGCGCAAGGC
GATCTACGACCAGGCCCAGGCGCTGCTGCAGGCCGACACGCACGATATCTACCTGTAC
TACCAGCCGTGGCCGTTCGTGCTGGGCAAGAACGTACGCGGCTTCAAGCCGTACCCGG
ACGGCATGGTGCGCCTGAAGGGCGTGACGCTGGTCAAGTAGcgacggtgggggcggcgggccgccgcagc
ggcggccggctgccgcgatcggcgcggcgcgcgggcgccgccgcgcccgtttttcgGTG

    BP2691 Gene: BP2691     GI: 33593658     BI number: BP2691     GOG: COG0601     Description: ABC-transport protein, inner membrane componen cg        gc g  g      c  c cg        cg gc        gc cg        cg gc        gc gc        gc cg        gc gc        cg             tttttcgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................