                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-21.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.93 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-21.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGAGGACACCGGCTTCTACGAGTACGAGAAGGACGGCCACAAGGTCCAGATGAACAA
GGACGACGTCAAGACGATCGAGGAGGTCAAGTAGgcgagggttcgcggtccaggctcggcgaggctcttcccgcc
gccgccgaaccgtgaaaaaaagcccgccggcgcgatgctggcgggcttttctcgcgcaagcggccctagctgtgaagattcaataggttgtatgcatggt
tcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG

    BP2781 --- BP2780 Gene: BP2781     GI: 33593737     BI number: BP2781     GOG: COG2801     Description: transposase Gene: BP2780     GI: 33593736     BI number: BP2780     GOG: COG2055     Description: putative malate dehydrogenas   c t  t c  t gc gc a  | gc cg gc gc         a cg       a  a t  |      g  a c  |      t  a g  |      g  a g  |      c  a a  |      c  g c  |      a  c        g c  |      a  c      c  a t  |       gc       g  t gc        cg        cg gc       c  c       gc cg        gc        gt |  c       cg        cg gc        cg        cg cg        gc        gc ta       c  |       cg ta        cg        cg gc        gc        cg gc        cg        gc                         ttttctcgcgcaagcggccctagctgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2801 Transposase and inactivated derivatives ... can be seen here [C] COG2055 Malate/L-lactate dehydrogenases ... can be seen here     ..................................................................................................................