                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=20 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGGTCACCAACGCCGACGTCGCCGAAGGCCTGCGCAAGGCCGGCTTCGAAGCCGTC
GAGAAGTCGCAGGTGCGCATGCCCAATGGCCAGATCAAGGCCGTGGGCGAGTACCTTG
TGCAAGCGGTGCTGCACGCCGACGTCGTTGCCGACGTGGTGGTGCTGGTCGAAGGCGA
AATGGCCTGAttgtccggcatgcctgaaaaaagccggcctggtgccggcttttttttcgagggcggcgcgggccgcgggaggcgcgctaccat
cagcgccattgtttctgctcaggggatgccggtTTG

    BP2792 --- dnaB Gene: BP2792     GI: 33593748     BI number: BP2792     GOG: NOG09259     Description: hypothetical protein Gene: dnaB     GI: 33593747     BI number: BP2791     GOG: COG0305     Description: DNA helicas            gg        cc           c  g      a  a           g  a      t  t cg        cg       c  c g  g       cg       g  a cg        gc        cg gc       g  g       gc gc        gc        cg cg        cg        gc gc        gc        gc                         attgtttctgctcaggggatgccggtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0305 Replicative DNA helicase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.40 kcal/mol Antiterminator: Size=23 nt.     Delta G= -7.12 kcal/mol Anti-antiterminator:   Size=38 nt.     Delta G=-17.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTCGGTCACCAACGCCGACGTCGCCGAAGGCCTGCGCAAGGCCGGCTTCGAAGCCGTC GAGAAGTCGCAGGTGCGCATGCCCAATGGCCAGATCAAGGCCGTGGGCGAGTACCTTG TGCAAGCGGTGCTGCACGCCGACGTCGTTGCCGACGTGGTGGTGCTGGTCGAAGGCGA AATGGCCTGAttgtccggcatgcctgaaaaaagccggcctggtgccggcttttttttcgagggcggcgcgggccgcgggaggcgcgctaccat cagcgccattgtttctgctcaggggatgccggtTTG     BP2792 --- dnaB Gene: BP2792     GI: 33593748     BI number: BP2792     GOG: NOG09259     Description: hypothetical protein Gene: dnaB     GI: 33593747     BI number: BP2791     GOG: COG0305     Description: DNA helicas AA A  T G  G CG GC GC AT |  G |  A        g         g At       t  a      t  g Gt       c  a      c  t Cg       c  a       cg T  t      g  a       gc Gc       t  a       gc Gc       a  a       cg Tg        cg        cg Cg        gc        gc Gc        gc        at Ta        cg        at Gt        cg        at                         tttttcgagggcggcgcgggccgcgggaggcgcgctaccatcagcgccattgtttctgctcaggggatgccggtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0305 Replicative DNA helicase ... can be seen here     ..................................................................................................................