                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-14.40 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTCCTGGACCTGGCCCACCGCATCGGCGCGGCGCGCGCCTGGCGGCCGGACGCCT
GGGGCGTGCCGGCAATCACGGCCGCCGTGTTCGCGCTGTCGGCGCTCGCCAGCTGGAT
GTTGCGCCGGCATCGGTTGACCCGCCGGCTGGTCTAAagcgtattgagaattaccaccctggttaacccggat
ggggtacaattcccggtttgggatcggccagaccgatttttcttcgcgccagaacggcatgagcgacacgacctcagccgtcctggctttttcatccgtg
cggagggaatcATG

    BP2804 Gene: BP2804     GI: 33593760     BI number: BP2804     GOG: COG4638     Description: putative iron-sulfur protei   a t  a        a t  c      c  a gc       a  t gc       t  t tg        gc cg        gc        tc |  a       gc       a  g |  t      g  g      g  g cg        tg        gc cg        at        gc a  |       gt        ta cg        gt        tg cg        cg        ta at        cg        gc ta        cg        gc                         gatttttcttcgcgccagaacggcatgagcgacacgacctcagccgtcctggctttttcatccgtgcggagggaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PR] COG4638 Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit ... can be seen here     ..................................................................................................................