                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-17.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgatgaaaataaaatggtgtcgcatctattgccgaccacgcgcggcgcagtgggcgcataatcggccggggttggcggcaaaatagggcccgaaacaccg
atataagctgaacgatagtggtgattggcgattttgcgggggttggaagtaagtgactgctcaggccgcaaaatggcgcctgaagcgccgcctacggcat
gccggcaccctcaaaatgagggggcgagtttatttcagggcccaaatccgtcaaaatagcgtcttttaatggttttttggctaaagccgggggatgctct
GTG

    BP2815 Gene: BP2815     GI: 33593769     BI number: BP2815     GOG: COG1501     Description: hypothetical protei aa a  t a  g cg gc c  | cg gc gc at cg |  a ta cg gc t  | c  |       ct a  |      c  a g  |       gc t  |       cg g  |       cg a  |       gc a  |      |  a t  |      |  t g  |       cg a  |       gc         a a  |      a  c      a  a g  |      a  |      a  t g  |      g  |       cg t  |      t  |       ta tg        cg        cg gc        cg        cg gc        gc        cg g  g      c  a      a  g gc        gc        cg gc        gc        gc                         gagtttatttcagggcccaaatccgtcaaaatagcgtcttttaatggttttttggctaaagccgggggatgctctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1501 Alpha-glucosidases, family 31 of glycosyl hydrolases ... can be seen here     ..................................................................................................................