                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:109 nt. Size=33 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=20 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACC-TATCGT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACCGTCGGGGCCGCGCTGTGTATCGTGGCAATAGGAATGGATATCGGCCCCGGCG
GCGCGCGCCGCCTCCAGGAATTTGGCGCGGGCCTGCGCATAGGTTTCGGAGAAAGGAT
CGGACGCGTGCACattggctcctagacatgggttggcaaattcaatcccattctacggaatggttctggaattttttttcgttttcccgct
cgagatatgccgtttacaggtgaaatcATG

    BP2870 Gene: BP2870     GI: 33593813     BI number: BP2870     GOG: COG0318     Description: putative acid CoA ligas                      ac             a       t  g           a  a       cg           c  t       ta            gt        ta            gc        at            ta        cg            ta        cg ac       |  t      |  t g  a       gc       c  t at        gc       t  c tg        gc       a  t cg        ta       a  g cg        at        cg |  t      c  |       ta |  t       at        ta tg        gc        at cg        at        at gc        ta        at                         tttttcgttttcccgctcgagatatgccgtttacaggtgaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here     ..................................................................................................................