                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=10 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-26.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGCTGCAGCGGGGCATGAGCCTGTCGGAACAGGACGTCAAGTCGTACGTCCTGGCCA
ATGCGCCGGCCTACCAGCATCCGCGCCGCGTGTTCTTCGTCGAGTCGCTGCCGCTGGC
GGCCACCAGCAAGGTGGACCGGCGCGCCCAGGCCGAGGCGTAGcgcaagaagactgtgccgatcggca
atgggctgctccatgagcagcccattccaattccgggcccggacacgcccgagaaggcacttattttccacgcgccggcgcgtagcatggatccatcgca
tcaataaggtggagacATG

    BP2871 Gene: BP2871     GI: 33593814     BI number: BP2871     GOG: COG5553     Description: hypothetical protei   a c  t cg ta cg gc ta cg gc gc gc                  ga ta                 g  c at                 c  a at                 c  c c  |                 cg gc                  gc gc                  gc c  a                 gc ta                  cg at                 |  a gt                  cg |  c                 ta |  c       gc        ta |  g      g  c      a  | cg        gc       a  | cg        cg        cg gc        cg        cg                         cacttattttccacgcgccggcgcgtagcatggatccatcgcatcaataaggtggagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5553 Predicted metal-dependent enzyme of the double-stranded beta helix superfamily ... can be seen here     ..................................................................................................................