                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=2 nt.   Size=20 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gggcagcgatgggtttgtagcaagccgtaaggcgtaaagcgcgggcttgcggtttcgggtcggccacgccaggcgtgttctgatatgagggggccgacgg
cttgcctgtgggcacatgaccggatcggccatgttgctgccatatgatgatatatggcgttatgggtaagcatgaataaccaagcattctagtgcatgga
attttgtttgtcaagaacctgtcgcaggcgcctgtcacagatcgcttcgatggcaacaaagtgcctgctccaggggagttttccggatgccagcccgata
ATG

    BP2886 Gene: BP2886     GI: 33593826     BI number: BP2886     GOG: NOG05448     Description: putative lipoprotei            ta           g  a           g  g            gc            ta            at            tg            ta           |  a           |  t           g  a           c  a            gc            gc tg        ta        ct a  a      a  a      t  a gt       t  g       tg ta       a  |       at at       t  |       cg ta       a  |       gc at        gc       a  a cg        ta        at cg        at        cg gc        gt        cg                         aattttgtttgtcaagaacctgtcgcaggcgcctgtcacagatcgcttcgatggcaacaaagtgcctgctccaggggagttttccggatgccagcccgataATG     ..................................................................................................................