                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.09 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGGAAGGGAACGATCAGGCGGATCGGCTTGTTGGGATAGGCGTCTTGGGCGTGCGC
GACGCCGGCGGCCAGCGGGGCGGCCAGGATCGCGGCGAGGGACAGGCCCAGGATGACA
TTACGACGTTGCATggtttcccctgtaggaagatgttcagatcagtgcgcgaactttgtggttcttggcacagactgcgtcattctgtaa
gggtgtctggtttgcgcaaacgaaagattctccgtaagctattccttttactcatggctggtttgtcataaaacctgaatcggcccctttttccATG

    BP2894 --- trmU Gene: BP2894     GI: 33593834     BI number: BP2894     GOG: COG0583     Description: putative LysR-family transcriptional regulator Gene: trmU     GI: 33593833     BI number: BP2893     GOG: COG0482     Description: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferas aa a  g g  a        t c  t      t  t a  t      t  a a  c      c  c a  t      c  t c  c      t  c gc        ta cg        at gt        tg        aa ta        cg       t  a ta        gc       a  a tg        at       c  c gc       a  |      t  c gt       t  |      g  t ta       g  |       tg c  t       cg        ta t  |       cg        ta g  |      t  t       gt t  |      c  t       gc gt       t  t       tg gc        tg        cg gc        at        gc at        gc        gc                         cctttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here [J] COG0482 Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain ... can be seen here     ..................................................................................................................