                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-23.20 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatgaactccgtaaagtgaagaacacagcaagcacggtggcgcgccgggacggcgcacacgcgcagtgtgcgcggaccgcatcggcgcgtcgcgcgagcc
ggtgtttttcttacagcctgctgccgggcgcgtcagtcacgggcaaggcggcggatcgccggattcgtcgtccccggggtatcgctgcgccatgcggcgc
aatgccgccaaccggcggcggacggcgcggcaggcaagatgacgcgattgtcagaagattgtgcgcgagcgtgggaaaccgctgtttataatctcggacc
ATG

    BP2923 Gene: BP2923     GI: 33593861     BI number: BP2923     GOG: NOG42262     Description: putative lipoprotei             g           c  c           g  a            cg            at            cg   g        at g  a       cg gc        gc cg        cg cg        gc         g gc       |  g      c  c cg       |  g      t  g gc       |  a       gc c  a      |  c       cg g  |       gc       g  a gc        cg        cg ta       a  c       gc g  |      g  a       gc gc        gt        cg cg        gc        tg a  c       cg        at cg        cg        cg gc        gc        gt                         ttttcttacagcctgctgccgggcgcgtcagtcacgggcaaggcggcggatcgccggattcgtcgtccccggggtatcgctgcgccatgcggcgcaatgccgccaaccggcggcggacggcgcggcaggcaagatgacgcgattgtcagaagattgtgcgcgagcgtgggaaaccgctgtttataatctcggaccATG     ..................................................................................................................