                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggacaggcactgtctcgttcatggcgtatgacggggagcctgtcccggccgggacaggccccctcgccatgcggggacaggcgccccgtcatgcgcacgc
gggctcctgtcgttcccgcgccattcacggcgcgcccgcccggcggagagacggatttttgcggtgcagcatcggcgcggcctcggcggcgcaaggccgg
catcttgataaaaccccatcaacaggacgtatgacaacgtgtaatatcctgcgggtattgcttatttctcaaaatccgtagcatcaggaggagcctgaag
ATG

    BP2963 Gene: BP2963     GI: 33593898     BI number: BP2963     GOG: COG4663     Description: putative exported solute binding protei   c a  g a  t cg at g  a        g ta       t  c at        cg ta        cg g  |       tg c  |       at at        ta gc        at gc        at at        tg cg        gc             ttatttctcaaaatccgtagcatcaggaggagcctgaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG4663 TRAP-type mannitol/chloroaromatic compound transport system, periplasmic component ... can be seen here     ..................................................................................................................