                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAAAGCCGTAGCCAAGAAGGCCGTCGCCAAGAAGGCGCCTGCCAAGAAGGCTGCGC
CCAAGAAGCCCGCGACGCCTCCTTCGACCGCTGCCGCTCCGGGCGCGAAGACTGCGCT
GAACCCCGCTGCGTCGTGGCCGTTCCCGACCGGCGGCCGTCCGTAAcggacctcttcgccagttag
cagcaccttaagccgcctggctccgccaggcggctttttccgtcccgcgccttcgcccgcattcgcggcccgcgctatcttttgacgcccgccatgcgac
aataaaagccgttattgtTTG

    BP2986 Gene: BP2986     GI: 33593918     BI number: BP2986     GOG: COG0762     Description: putative integral membrane protei   t c  t c  a a  a cg gc a  c cg gc a  | t  | t  | gc at cg cg gc         c c  |      t  c t  |       cg t  |       gc c  |       gc t  |       ta c  |       cg c  |       cg at        gc gc        cg gc        cg cg        gc             tttttccgtcccgcgccttcgcccgcattcgcggcccgcgctatcttttgacgcccgccatgcgacaataaaagccgttattgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0762 Predicted integral membrane protein ... can be seen here     ..................................................................................................................