                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=18 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGCGTGACACCGTATTGAtcgcccgctgcttccggcaagacgcccgcttcatgcgggcgtttttttgcggcggcgggtcggga
gtcggcgggtgccagtccccctgcggggggcaggcacgccacccctccccgggtgccagtcccctcctgcggggacaggcacccggggagggggtatttt
tgtgaccgccgatgttttttcaggcggccgtcagaatccggaaagtatagtcgcgctcgaaactctgggggcggggtgtatatgcctgacgaggcaacct
gcacactgaccagccATG

    BP2991 --- dltD --- BP2989 --- dltB --- dltA Gene: BP2991     GI: 33593923     BI number: BP2991     GOG: -------     Description: acyl carrier protein Gene: dltD     GI: 33593922     BI number: BP2990     GOG: -------     Description: putative protein involved in the transfer of D-alanine into teichoic acids Gene: BP2989     GI: 33593921     BI number: BP2989     GOG: -------     Description: hypothetical protein Gene: dltB     GI: 33593920     BI number: BP2988     GOG: COG1696     Description: putative protein involved in the transfer of D-alanine into teichoic acids Gene: dltA     GI: 33593919     BI number: BP2987     GOG: COG1020     Description: putative D-alanine-D-alanyl carrier protein ligas            ag           c  g           a  c           g  a            gc            gc            gc            cg           g  | ct        tg c  g       cg t  c       cg cg        ta cg        cg cg        cg cg        cg ta        cg gc        tg             tatttttgtgaccgccgatgttttttcaggcggccgtcagaatccggaaagtatagtcgcgctcgaaactctgggggcggggtgtatatgcctgacgaggcaacctgcacactgaccagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1696 Predicted membrane protein involved in D-alanine export ... can be seen here [Q] COG1020 Non-ribosomal peptide synthetase modules and related proteins ... can be seen here     ..................................................................................................................