                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.60 kcal/mol
Antiterminator:    Distance from promoter:23 nt. Size=25 nt.     Delta G= -3.13 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttcca-taccat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttccagcgcccttgccctccattaccattcggccttcaaaaatacgcaagagccgatttacagaaaaccaaacggcaccaccaagtgccttttttgtgc
ccgccacccagcacgagccggagcaggcagtcttttaaatacatgctgtaaaacaggagccaaccaatcATG

    BP3050 --- BP3051 Gene: BP3050     GI: 33593978     BI number: BP3050     GOG: NOG09800     Description: putative membrane protein Gene: BP3051     GI: 33593979     BI number: BP3051     GOG: COG3333     Description: putative membrane protei   a a  t a  a        a a  c      g  a a  g      a  a c  c      c  a ta       a  c ta       t  c       cc cg       t  a      a  a |  a      t  a      c  a cg       a  a       cg gc        gc        at gc        cg        cg cg        cg        gc ta        gc        gc                         ttttttgtgcccgccacccagcacgagccggagcaggcagtcttttaaatacatgctgtaaaacaggagccaaccaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3333 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................