                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-24.40 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGATCCGCAAGAAGCGCGAGGAAACCTTCGTCGAGGAAGAATGAtccctcgatgcggccggc
gcctgccggccggcgcgaaccgggccctcgggcccggtttttttttgcctcggcttcgcagtgccgcatgcctgtcctgccccgacgcgcggggtgccgg
tccccgcagggacgggcgccccatacgccatgggcaccaggccgtaagatttcaaactgcaaccaatcacaacaaatttgacatgaatcggccgcgagtg
cgttaagctacgggtttacccgtgtctatcggcttGTG

    BP3052 Gene: BP3052     GI: 33593980     BI number: BP3052     GOG: COG0405     Description: putative gamma-glutamyltranspeptidas AT A  G G  A A  t A  c Gc        cc Gc       g  t At        cg Gc        gc Cg        gc Ta        cg Gt        cg Cg        gc T  c       gc T  |      |  g Cg        cg Cg        gc        tc A  |       tg       c  g A  |      a  |       cg A  |       gc        cg Gc        cg        gc Gc        ta        gc A  g      |  a       gc G  |      |  c       cg Cg       |  c       cg Gc        cg        at Cg        cg        at Gc        cg        gt                         ttttttgcctcggcttcgcagtgccgcatgcctgtcctgccccgacgcgcggggtgccggtccccgcagggacgggcgccccatacgccatgggcaccaggccgtaagatttcaaactgcaaccaatcacaacaaatttgacatgaatcggccgcgagtgcgttaagctacgggtttacccgtgtctatcggcttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0405 Gamma-glutamyltransferase ... can be seen here     ..................................................................................................................