                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCAGCGGGCCATCGAACTGTTCCAGCCCGACGCCCTGGTGTTGTCGCTGGGCTTCG
ATGTGTTCGAGAAAGACCCGCAAGCCATGGTGGCGGTCAGCGCCAATGGCTTCGAGCG
CCTGGGCCAGGCGATCGGCGCCTTCAAGCTGCCGACGTTGATCGTGCAGGAAGGCGGC
TACTATATCGAGGGCCTGGAGGACAACGCCGAGCGCTTCTTCGCGGGCCTGGCCAAGG
CCTGAggtcccgcctgtccatccggaaaaggcggccgcggccgccttttttcatgccttccacaaaccATG

    BP3064 Gene: BP3064     GI: 33593991     BI number: BP3064     GOG: COG0583     Description: putative transcriptional regulato AA C  G CG GC        tc GC       a  c |  T       cg |  G       cg TA        ta        gc Cg       |  a      c  g Cg       g  a       cg |  t       ta        gc Gc        cg        gc Gc        cg        cg Gc        gc        gc Cg        cg        gc Gc        cg        at                         tttttcatgccttccacaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................