                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-17.90 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G=-33.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAGCGTCAACGCCTTGCAGCCGCCCAGCGCGGTGTCGAAATAGTCGTGCGGGTCCGG
CCCTTCGCCCTGCGGTTGCGGCATGGCCAGCGGCAGTTCGTGGCCTTCGGCGGTGGCG
GTGTACTGCAGTCCGCCGGGGGTGTTGGCGCGCACTTGGATCGTCATgggatgtctccgttcagg
cgcggccccgctggctgcgcgtccaggttttgtaccatgggcgccgcctgacaaccggctgaactatttggcagaccgccagtcagacggtaattccacg
caagacacaggagtccacaTTG

    BP3218 Gene: BP3218     GI: 33594125     BI number: BP3218     GOG: COG2979     Description: putative membrane protei GT T  A GC GT CG GC |  A G  G T  T GC GC CG GC GC CG TG TG        Tg CG       A  g CG        Cg GT        Ta |  G       Gt |  T       Cg |  T      |  t        g |  G      T  c      c  c |  G       At       c  t GC        Gc        cg TG        Gc        cg GC        Tg        gc CG       |  t       gt T  C      |  t       cg TA       T  c       gc GC       C  a       cg AT       A  g       gc |  T       Cg       g  g |  G       Gc       a  t |  G       Cg       c  c C  A       Gc       t  c GT       |  g      t  a GC        Cg       g  | CG        Gc        cg GT        Gc        cg                         ttttgtaccatgggcgccgcctgacaaccggctgaactatttggcagaccgccagtcagacggtaattccacgcaagacacaggagtccacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2979 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................